Портал функционирует при финансовой поддержке Федерального агентства по печати и массовым коммуникациям.

Выбрать дату в календареВыбрать дату в календаре

Страницы: 1
СПИД - самая чудовищная мистификация 20 века!
Боюсь батенька тролль искать Ваши несуществующие ответы в мои планы так же не входит.
Но за разрешение действовать дальше - отдельное спасибо. При случае обязательно буду постить в теме что-нибудь ещё.  ;)
СПИД - самая чудовищная мистификация 20 века!
Собственно, это можно понимать так, что ответа на  комментарии к приведенным Вами исследованиям ожидать не приходится?  :D
СПИД - самая чудовищная мистификация 20 века!
[QUOTE]Sapiens пишет:
А умеете обращаться с лабораторным оборудованием. [/QUOTE]
Вы сомневаетесь, что удастся собрать необходимую команду?  :)
СПИД - самая чудовищная мистификация 20 века!
Вам - это мне?

Само по себе это ничего не докажет. Нужно будет прождать лет 20 и да ещё и останется вероятность умереть от какого-нибудь ещё не обнаруженного вируса полученного в результате переливания, действие которого приписывается ВИЧ.

Но забиться можно. Если будет выполнено два условия.

В оппонентах должен быть один из активных не инфицированных сторонников ВИЧ-теории, из тех, кто утверждает, что ошибки в теории быть не может. Он должен будет публично пообещать покончить жизнь самоубийством в случае, если теория окажется неверна.
Ну и, чтобы я был уверен в прогрессе, мне должен быть предоставлен  доступ ко всем уже проведенным исследованиям, а также к лабораториям для проведения исследований своих.

Кроме этого, на том форуме, ссылку на который я давал, были люди которые утверждали что переливания были.
Дьюсберг заявлял, что неоднократно писал о согласии участвовать в подобном эксперименте, однако ответов от официальных органов ни разу не последовало.
СПИД - самая чудовищная мистификация 20 века!
По ссылке которую я давал, эти исследования обсуждались и, пока, последнее слово было за диссидентами.

3.6.2010, 14:59
ti-griks
[QUOTE]В то время, когда каждый заявляет, что «СПИД вызван ВИЧ», такое утверждение должно быть подкреплено, по крайней мере, одной библиографической ссылкой. Вы будете удивлены, узнав, что такой ссылки не существует, не было её и в начале 1980-ых. Кэри Муллис (Karry Mullis), получивший Нобелевскую премию 1993 года за открытие метода ПЦР (полимеразноцепная реакция – прим. переводчика) (PCR), настойчиво искал такую ссылку, но не нашёл (2). Все, что Вы найдете – это ссылка на самую знаменитую пресс-конференцию, которая имела место в Вашингтоне, округ Колумбия, 23 апреля 1984 и во время которой, Маргарет Хеклер (Margaret Heckler), секретарь Службы Здравохранения (Health and Human Services), гордо объявила в присутствии Роберта Галло (Robert Gallo), что ретровирус был только что обнаружен и что он является, «вероятно», причиной СПИДа. Следующим утром, все газеты в США и во всем мире, вышли с большими заголовками, в которых они опустили только одно слово - слово «вероятно»... С тех пор СМИ никогда не останавливались, неся огромную ответственность за общественную дезинформацию относительно причинной обусловленности СПИДа. (продолжение на h ttp://anti-spid.boom.ru/)
[/QUOTE]

5.6.2010, 14:29
Tatiyana_D
[QUOTE][I]Barre-Sinoussi F. et al. Isolation of a T-lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science 1983, v. 220, p. 868.
(Выделение Т-лимфотропного ретровируса от пациента с риском приобретенного иммунодефицита)

Gallo R. et al. Isolation of human T-cell leukemia virus in acquired immune deficiency syndrome (AIDS). Science 1983, v. 220, p. 865.[/I]
(выделение вируса Т-клеточной лейкемии человека при синдроме приобретенного иммунодефицита)

Это то, что было ДО той самой пресс-конференции, о которой писал Нобелевский лауреат Кэрри Мулис.
[/QUOTE]

5.6.2010, 16:12
Скерцо
[QUOTE]Во-первых, Муллис не увидел доказательств того, что ВИЧ вызывает СПИД и в этих двух исследованиях таких доказательств нет. Там есть только намек на выделение вируса, хотя на самом деле обнаруживают не сам вирус а обратную транскрипцию.
Но это уже более предметный разговор.
Хоть в этой теме уже разбирали эти два исследования, можно и повториться, надеюсь ПОСЛЕ этого, уже никто не будет пытаться приводить их в качестве аргумента.
Итак, исследование Галло и Поповика.
[QUOTE][I]Several isolates of a human type-C retrovirus belonging to one group, known as human T-cell leukemia virus (HTLV), have previously been obtained from patients with adult T-cell leukemia or lymphoma. The T-cell tropism of HTLV and its prevalence in the Caribbean basin prompted a search for it in patients with the epidemic T-cell immune deficiency disorder known as AIDS. Peripheral blood lymphocytes from one patient in the United States and two in France were cultured with T-cell growth factor (TCGF) an shown to express HTLV antigens. Virus from the U.S. patient was isolated and characterized and shown to be related to HTLV subgroup I. The virus was also transmitted into normal human T cells from umbilical cord blood of a newborn. Whether or not HTLV-I or other retroviruses of this family with T-cell tropism cause AIDS, it is possible that patients from whom the virus can be isolated can also transmit it to others. If the target cell of AIDS is the mature T cell as suspected, the methods used in these studies may prove useful for the long-term growth of these cells and for the identification of antigens specific for the etiological agent of AIDS.
[/I][/QUOTE]
Итак, в этом исследовании Галло и Поповик всего лишь обнаруживают наличие обратной транскрипции и то - не сразу. Чтобы её добиться они смешали кровь 10 больных СПИДом и одного больного лейкемией и только тогда получили свою обратную транскрипция, на основании чего заявили, что выделили вирус, хоть это совсем не так. Возможно на тот момент времени От означало наличие ретровируса, но на сегодняшний день понятно, что обратную транскрипцию могут производить и обычные человеческие клетки, и бактерии и особенно кровь с лейкемией, которую и использовали эти два горе-ученых. Кроме того, для получения ОТ они использовали образец клеток, полученный ранее от больного с лейкемией, поэтому, совершенно неудивительно, что после этого начала образовываться обратная транскрипция в образзах взятых от СПИД-пациентов и смешанных с кровью больного лейкемией.
И помимо всего прочего, в этом исследовании нет никаких доказательств того, что ВИЧ вызывает СПИД. Если вы его увидели, то прошу процитируйте, в каком месте? Потому что я заметила только одну фразу касающуюся этого момента и она такая
[I]"Вызывает ли HTLV-1 или другие вирусы этого семейства с тропностью к T-клеткам СПИД или нет, возможно, что больные, у которых может быть выделен вирус, могут также передавать его другим"[/I]
это не утверждение, это всего лишь предположение, как и все в этой теории, но доказательств не существует в природе. Или может быть оно у вас где-то завалялось? - если так, то покажите. ))))

Второе исследование Монтанье.
[QUOTE]A retrovirus belonging to the family of recently discovered human T-cell leukemia viruses (HTLV), but clearly distinct from each previous isolate, has been isolated from a Caucasian patient with signs and symptoms that often precede the acquired immune deficiency syndrome (AIDS). This virus is a typical type-C RNA tumor virus, buds from the cell membrane, prefers magnesium for reverse transcriptase activity, and has an internal antigen (p25) similar to HTLV p24. Antibodies from serum of this patient react with proteins from viruses of the HTLV-I subgroup, but type-specific antisera to HTLV-I do not precipitate proteins of the new isolate. The virus from this patient has been transmitted into cord blood lymphocytes, and the virus produced by these cells is similar to the original isolate. From these studies it is concluded that this virus as well as the previous HTLV isolates belong to a general family of T-lymphotropic retroviruses that are horizontally transmitted in humans and may be involved in several pathological syndromes, including AIDS.
[/QUOTE]
То же самое - обнаружение обратной транскрипции: вирус от этого пациента (я понимаю это как зараженный образец от пациента, так как вирус напрямую не выделялся) был помещен в культуру лимфоцитов из пуповинной крови и вирус стал производить с помощью этих клеток такие же частицы, как и в первом образце.
Но, существуют научные доказательства тому, что пуповинные клетки могут производить обратную транскрипцию и она очень активно производит эндогенные ретровирусы. Поэтому, опять же неудивительно, что в этом случае Монтанье наблюдал производство вирусоподобных частиц.
Если есть желание, я могу привести исследования, в которых показано что кровь больных лейкемией и пуповинная кровь способны производить обратную транскрипцию. Этот факт перечеркивает всю ценность приведенных вами двух исследований в качестве доказательства изоляции вируса, его там нет.
Помимо всего прочего, на снимке, опубликованном группой Галло, частицы совершенно не подходили по морфологическим свойствам под ретровирусы, они были намного бОльшего размера и у них не было даже присосок-отростков. Монтанье же вообще не опубликовал снимки. И позже, когда его спросили об этом, он ответил, что его "группа не выделяла вирус".
Прямой изоляции вируса ни в том, ни в другом исследовании нет. Точно так же, как там нет доказательств того, что ВИЧ приводит к СПИД. Я бы даже сказала - наоборот, потому как у большинства СПИД-пациентов Галло так и не смог обнаружить даже обратную транскрипцию, что он сам не отрицает.
[/QUOTE]

15.6.2010, 14:22
js08
[QUOTE]
Вот исследование, в котором Монтанье описывает своё открытие и убеждается в том, что оно не приводит к необратимому иммунодефициту (СПИД).

[QUOTE][I]From the Viral Oncology Unit, Institut Pasteur; Paris, France. Annals of Internal Medicine.
1985; 103:689-693

Lymphadenopathy-Associated Virus: From Molecular Biology to Pathogenicity

LUC MONTAGNIER, M. D.

Abstract
Recent data indicate that the lymphadenopathy-associated virus (LAV) is morphologically similar to animal lentiviruses,
such as equine infectious anemia and visna viruses.
This finding, together with the cross-reactivity of the core proteins of LAV with those of the equine infectious anemia virus and a similarity in genome
structure and biological properties, allows LAV to be placed in the retroviral subfamily of Lentivirinae.
Molecular data indicate a high degree of genetic variation of the virus, especially in the envelope gene,
which have important implications for the origin of the virus (the T4 lymphotropism may be a recently acquired property)
and for future immunization. Another problem is the role of viral infection in the induction of irreversible immunodeficiency.
This syndrome occurs in a minority of infected persons, who generally have in common a past of antigenic stimulation
and of immune depression before LAV infection.[/I]
[/QUOTE]
Вирус, ассоциированный с лимфаденопатией: от молекулярной биологии до патогенности
Люк Монтанье

"Недавние данные указывают, что вирус, ассоциированный с лимфаденопатией LAV (ВИЧ), морфологически схож с лентивирусами животных, такими как вирус инфекционной анемии лошадей и вирус visna.
Эта находка, вместе с перекрестной реактивностью капсидного белка LAV с капсидным белком вируса инфекционной анемии лошадей и сходством структуры генома и биологических свойств, позволяет отнести LAV к ретровирусному подсемейству лентивирусов.
Молекулярные данные указывают на значительную генетическую вариабельность этого вируса, особенно гена оболочки, из чего можно сделать выводы в отношении происхождения этого вируса (тропность к T4-лимфоцитам может быть недавно приобретенным свойством) и будущей иммунизации. [B][U]Другая проблема — роль вирусной инфекции в возникновении необратимого иммунодефицита[/U].
Этот [U]синдром[/U] наблюдается [U]у меньшинства инфицированных людей[/U], для которых характерны перенесенная антигенная стимуляция и [U]угнетение иммунной системы до инфицирования LAV[/U][/B]. [/QUOTE]

PS: Ещё было на эту тему

Мария Папагианниду-Сен-Пьер "Прощай, СПИД!"
[QUOTE]
Что произойдет, если запросить специальные научные источники, которые доказывают, что ВИЧ приводит к СПИДу? Вот слова Нобелевского лауреата Кери Муллиса, как они были записаны в документальном фильме Гари Нулла «AIDS inc.» (2007):

[I]Сейчас исследователи СПИДа начинают нервничать, если им задать какой-либо вопрос. Было время, когда я начал задавать вопросы. Все что я хотел узнать - это «Где же документы?», «Просто скажите, какие вы читали документы, убедившие вас в том, что ВИЧ вызывает СПИД, потому что мне нужно сослаться на эти документы», - я как раз работал над тестом, определяющим ВИЧ при помощи ПЦР, и мне нужно было написать небольшой отчет для Национального института здравоохранения и показать достигнутый нами прогресс. Первым ответом было: «ВИЧ - это возможная причина СПИД», и я подумал, что это правда, прежде чем включился в суть дела. Я сказал: «Где же ссылка для цитирования?». Я искал ее в течение двух или трех лет, и так и не нашел. Целых два года на каждой встрече, где говорили про СПИД, я всем и каждому задавал этот вопрос. Знаете ли, я у всех спросил, я просмотрел все компьютерные базы данных. Ссылки нет. Нет никого, кто отвечает за истинность этого утверждения. Теперь мы имеем весьма странную ситуацию в науке, где получение признания за открытие является самым важным в жизни ученого.[/I][/QUOTE]
Изменено: Warlock - 19.06.2010 12:09:55
СПИД - самая чудовищная мистификация 20 века!
На форуме первого канала в связи с передачей ВИЧ/СПИД разгорелась дискуссия по поводу передачи Гордона.
Появились следующие заявления:

[B]ArtificalIntelligent[/B]

[QUOTE]
Решил проверить данное утверждение на вшивость. Благо это моя прямая специальность - поиск генов в геноме человека.

Итак, берем последовательность gag ВИЧ-1 человека, выделенный в России (это не важно откуда, т.к. разница не большая).

Вот эта последовательности. Тут так же указаны все индификаторы, чтобы любой мог проверить, что это та самая последовательность, что я не написал ее из головы.

>gi|294992893|gb|GU991883.1| HIV-1 isolate Pat22 from Russia gag protein (gag) gene, complete cds; and pol protein (pol) gene, partial cds
ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGCCAAATGGGAGAAAATTCGG­TTGNGGCCAG
GAGGAAGAAACCAATATAAAATGAAACATTTAGTATGGGCAAGCAGGGAGATGGAGAGAT­TTGCACTTAA
CCCTGGCCTTATGGAAACAGCAGAAGGTTGTCAACAAATAATGGTACAGATACAACCAGC­TCTCAAGACA
GGAACAGAGGAGCTTAGATCATTATATAATACAATAGCAGTTCTCTATTGTGTACACCAA­AGGATAGAGA
TAAAAGACACCAAAGAAGCTCTAGAGGAAATAGAAAAGCTACAAAAGAAAAGTCAGCAAA­AAACACAGCA
GGCAGCAACAGATACAGGAAACAGTAGCCAAGTCAGCCAAAATTATCCTATAGTGCAGAA­TGCACAAGGG
CAAATGGTACACCAGGCCATATCACCTAGGACCTTGAATGCATGGGTAAAAGTAGTAGAA­GAAAAGTCCT
TTAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAGGATT­TGAATACCAT
GCTAAACACAGTGGGGGGGCATCAAGCAGCTATGCAGATGCTAAAGGAGGCTATCAATGA­TGAAGCTGCA
GAGTGGGACAGGTTACACCCACCACAGGCAGGGCCTATTGCGCCAGGCCAGATAAGAGAA­CCAAGGGGAA
GTGATATAGCAGGAGCTACTAGTACCCTGCAGGAGCAAATAACATGGATGACCAGCAACC­CACCTATCCC
AGTGGGAGAAATTTATAAAAGATGGATAATCTTGGGATTAAATAGAATAGTAAGAATGTA­TAGCCCTGTC
AGCATTTTAGACATAAGACAAGGGCCAAAAGAACCCTTTAGAGATTATGTAGATAGGTTC­TTTAAAACTT
TAAGAGCTGAGCAAGCTACACAGGAAGTAAAAAGCTGGATGACAGACACCTTGTTGRTCC­AAAATGCGAA
CCCAGATTGTAAGAACATCTTAAGAGCATTAGGACCAGGAGCTTCACTAGAAGAAATGAT­GACAGCATGT
CAGGGAGTGGGAGGACCCAGCCATAAAGCAAGAGTTTTAGCTGAAGCAATGAGCCAGGCA­TCAGGTGCCG
CAGCGGCCATAATGATGCAGAAAAGCAATTTTAAGGGCCCAAGAAGAGCTATTAAGTGTT­TCAACTGTGG
CAAGGATGGACATATAGCCAGAAATTGCAGGGCCCCTAGAAAGAAGGGCTGTTGGAAATG­TGGAAAGGAG
GGACATCAAATGAAAGATTGCACRGAGAGCAAGGCTCATTTTTTAGGGAAAATCTGGCCC­TCCAGCAGGG
AGAGGCCAGGGAATTTTCTTCAGAACAGGACAGAGCCAACAGCCCCACCAGCAGAGAGCT­TCGGGGAGGA
GATAGCCCCTGCCCCGAAACAGGAGCCGAAGAAGGAGGAGCTATATCCCTTAGCCTCCCT­CAAATCACTC
TTTGGCAGCGACCCYTAGTCTCAGTAAGAGTRGGGGGACAGCTAATAGAAGCYCTATTAG­ACACAGGAGC
AGATGATACAGTATTAGAAGACATAAATTTACCAGGAAAATGGAARCCAAAAATGATAGG­GGGAATTGGA
GGTTTTATCAAAGTAAGACAGTATGATCAAATACTTATAGAAATTTGTGGAAAAAAGGCT­ATAGGGACAG
TATTAGTAGGACCTACACCTATCAACATAATTGGGAGAAATATGTTGACTCAGATTGGYT­GTACTTTAAA
TTTTCCAATTAGTCCTATTGAAACTGTACCAGTAAMATTAAAGCCAGGAATGGATGGGCC­AAAGATCAAA
CAATGGCCATTGACAGAAGAGAAAATAAAAGCATTAATAGAAATTTGTACAGAAATGGAA­AAGGAAGGAA
AAATTTCAAAAATTGGGCCTGAAAATCCATACAACACTCCAATATTTGCTATAAAGAAAA­AAGACAGTAC
TAAATGGAGAAAATTAGTAGATTTCAGAGAGCTCAATAAAAGAACTCAAGACTTCTGGGA­GGTACAATTA
GGAATACCTCACCCAGCAGGGTTAAAACAGAAAAAATCAGTAACAGTACTAGATGTGGGG­GATGCATATT
TTTCAGTTCCATTAGATGAAAGCTTTAGAAAGTATACTGCATTCACTATACCTAGTATAA­ATAATGARAC
ACCAGGAATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAAT­ATTCCAAAGT
AGCATGACAAAAATCTTAGAGCCCTTTAGAAARAGAAAYCCAGAAATGGTGATCTACCAA­TACATGGATG
ATTTATATGTGGGATCTGACTTAGAATTAGGACAACATAGAGCAAAAATAGAAGAGTTAA­GAGAGCATTT
ACTGARATGGGGATTTACCACACCAGATAARAARCATCAGAAAGAACCTCCATTCTTRTG­GATGGGATAT
GAGCTCCATCCTGACAARTGGACGGTACAACCTATACAGTTGCCAGATAAAGARAGCTGG­ACTGTCAATG
ATATACAAAAGCTAGTGGGAAAACTAAATTGGGCAAGTCAGATTTATCCAGGAATTAGAA­TAAGGCAACT
ATGTAAACTCATTAGGGGGGCTAAAGCACTAACAGACATAGTACCACTAACARAAGAAGC­AGAGCTAGCA
CTA

Итак, кидаем эту последовательность в программ BLast против генома человека. Программа Blast ищет похожие последовательности. Это стандартная программ для поиска гомологичных (т.е. похожих) генетических последовательностей.

Вывожу результат работы программы:

Description
human build 37 genome database (reference GRCh37 and alternate assemblies) Program
BLASTN 2.2.23+

No significant similarity found.

Это означает, что в геноме человека, ни в одной известной сборке, такого гена нет. Даже близко нет, потому что даже если бы он был хоть чуть-чуть родственным, он бы нашелся. Более того, этого гена нет ни в одном известном геноме млекопитающего. Я это тоже проверил. Зато против вирусных последовательностей находится прекрасно. Кстати, этот фрагмент взят из генома вируса ВЫДЕЛЕННОГО в России ВИЧ-1. Вот работа

Knops,E., Daeumer,M., Awerkiew,S., Kartashev,V., Schuelter,E., Kutsev,S., Brakier-Gingras,L., Kaiser,R., Pfister,H. and Verheyen,J.
Evolution of PI resistance in the gag and pol gene of HIV subtype G isolates (работы сделана в Institute of Virology, University of
Cologne )

Это воспроизводимая процедура, которую может проделать любой и убедиться, что товарищи Вам наглым образом соврали. Последовательности gag вируса иммунодефицита человека в геноме человека не обнаружено.

Где его можно обнаружить, так это в ДНК лимфоцита ВИЧ инфицированного. Ну может еще в паре типов клеток, у которых эксперссированы нужные рецепторы цитокинов и CD4. Все-таки это ретровирус и он может по определению выстроиться в геном, чтобы размножаться.

Если речь идет о других вирусных изолятах, то данный изолят российского вируса похож больше всего на изолят вируса из кубы
HIV-1 isolate Cu87 from Cuba, complete genome.

Это вирус был изолирован в 2007 в ходе следующей работы:
J Acquir Immune Defic Syndr. 2007 Jun 1;45(2):151-60.
Identification of 3 phylogenetically related HIV-1 BG intersubtype circulating recombinant forms in Cuba.
Sierra M, Thomson MM, Posada D, Pérez L, Aragonés C, González Z, Pérez J, Casado G, Nájera R.

Желающие могут использовать Blast указанной последовательности и ознакомиться с несколькими тысячами прочитанных генов других изолированных вирусов ВИЧ, посмотреть, чем они отличаются и так далее.

Если мы можем отличить ВИЧ кубинский от ВИЧ русского, неужели кто-то думает, что мы не отличим ВИЧ от гена человека? [/QUOTE]

[B]ArtificalIntelligent[/B]
[QUOTE][QUOTE]Секвенирование для нас - дом родной, было бы что секвенировать. Вы же нам так и не объяснили, какого лешего некая фракция в градиенте плотности по умолчанию содержит только вирус и ничего кроме вируса? Хотя даже малым детям известно, что любая нуклеиновая кислота, включая хозяйскую, легко рвется на куски при механическим воздействии и может запросто попасть в ту же самую фракцию.[/QUOTE]

Нет, ну Вы точно не понимаете вообще о чем говорите. Какая фракция? Какой градиент плотности? Вы же не знаете как секвенируют. Сначала выделяют всю РНК. Там будет РНК вируса и РНК человека и РНК кишечной палочки, которая заползла в человека и так далее. Эту РНК превращают в ДНК. Затем с помощью ПЦР амплицифируют (размножают) последовательность, края которой нам известны - ту, которую мы хотим точно прочитать большим фрагментом. В результате у нас из нескольких молекулы образуется много миллиардов копий. И их отделяют на элетрофорезном геле. Затем эту последовательность встраивают в бактериальную плазмиду, защищающую бактерию от антибиоитика, при условии успешной вставки. Затем плазмиду встраивают в бактерий, делают это так, чтоб в каждую бактерию встроилось не более одной плазмиды. Бактерии с такой плазмидой вырастают и образуют колонию - клон (без плазмиды - дохут). Далее, использую специфические праймеры, которые соответствуют исключительно последовательности данной плазмиды и читают целиком последовательность вставки. А затем, сравнивают программой Blast все эту последовательность с вирусом.

Если последовательность совпала, значит в образце присутствовал самый настоящий вирус. Мы это знаем на 100%.

Вот если Вы возьмете образец крови человека и секвенатор, после упомянутой процедуры выдаст такое:

ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAAAATTAGCCAAATGGGAGAAAATTCGG­TTGNGGCCAG
GAGGAAGAAACCAATATAAAATGAAACATTTAGTATGGGCAAGCAGGGAGATGGAGAGAT­TTGCACTTAA
CCCTGGCCTTATGGAAACAGCAGAAGGTTGTCAACAAATAATGGTACAGATACAACCAGC­TCTCAAGACA
GGAACAGAGGAGCTTAGATCATTATATAATACAATAGCAGTTCTCTATTGTGTACACCAA­AGGATAGAGA
TAAAAGACACCAAAGAAGCTCTAGAGGAAATAGAAAAGCTACAAAAGAAAAGTCAGCAAA­AAACACAGCA
GGCAGCAACAGATACAGGAAACAGTAGCCAAGTCAGCCAAAATTATCCTATAGTGCAGAA­TGCACAAGGG
CAAATGGTACACCAGGCCATATCACCTAGGACCTTGAATGCATGGGTAAAAGTAGTAGAA­GAAAAGTCCT
TTAGCCCAGAAGTAATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAGGATT­TGAATACCAT
GCTAAACACAGTGGGGGGGCATCAAGCAGCTATGCAGATGCTAAAGGAGGCTATCAATGA­TGAAGCTGCA
GAGTGGGACAGGTTACACCCACCACAGGCAGGGCCTATTGCGCCAGGCCAGATAAGAGAA­CCAAGGGGAA
GTGATATAGCAGGAGCTACTAGTACCCTGCAGGAGCAAATAACATGGATGACCAGCAACC­CACCTATCCC
AGTGGGAGAAATTTATAAAAGATGGATAATCTTGGGATTAAATAGAATAGTAAGAATGTA­TAGCCCTGTC
AGCATTTTAGACATAAGACAAGGGCCAAAAGAACCCTTTAGAGATTATGTAGATAGGTTC­TTTAAAACTT
TAAGAGCTGAGCAAGCTACACAGGAAGTAAAAAGCTGGATGACAGACACCTTGTTGRTCC­AAAATGCGAA
CCCAGATTGTAAGAACATCTTAAGAGCATTAGGACCAGGAGCTTCACTAGAAGAAATGAT­GACAGCATGT
CAGGGAGTGGGAGGACCCAGCCATAAAGCAAGAGTTTTAGCTGAAGCAATGAGCCAGGCA­TCAGGTGCCG
CAGCGGCCATAATGATGCAGAAAAGCAATTTTAAGGGCCCAAGAAGAGCTATTAAGTGTT­TCAACTGTGG
CAAGGATGGACATATAGCCAGAAATTGCAGGGCCCCTAGAAAGAAGGGCTGTTGGAAATG­TGGAAAGGAG
GGACATCAAATGAAAGATTGCACRGAGAGCAAGGCTCATTTTTTAGGGAAAATCTGGCCC­TCCAGCAGGG
AGAGGCCAGGGAATTTTCTTCAGAACAGGACAGAGCCAACAGCCCCACCAGCAGAGAGCT­TCGGGGAGGA
GATAGCCCCTGCCCCGAAACAGGAGCCGAAGAAGGAGGAGCTATATCCCTTAGCCTCCCT­CAAATCACTC
TTTGGCAGCGACCCYTAGTCTCAGTAAGAGTRGGGGGACAGCTAATAGAAGCYCTATTAG­ACACAGGAGC
AGATGATACAGTATTAGAAGACATAAATTTACCAGGAAAATGGAARCCAAAAATGATAGG­GGGAATTGGA
GGTTTTATCAAAGTAAGACAGTATGATCAAATACTTATAGAAATTTGTGGAAAAAAGGCT­ATAGGGACAG
TATTAGTAGGACCTACACCTATCAACATAATTGGGAGAAATATGTTGACTCAGATTGGYT­GTACTTTAAA
TTTTCCAATTAGTCCTATTGAAACTGTACCAGTAAMATTAAAGCCAGGAATGGATGGGCC­AAAGATCAAA
CAATGGCCATTGACAGAAGAGAAAATAAAAGCATTAATAGAAATTTGTACAGAAATGGAA­AAGGAAGGAA
AAATTTCAAAAATTGGGCCTGAAAATCCATACAACACTCCAATATTTGCTATAAAGAAAA­AAGACAGTAC
TAAATGGAGAAAATTAGTAGATTTCAGAGAGCTCAATAAAAGAACTCAAGACTTCTGGGA­GGTACAATTA
GGAATACCTCACCCAGCAGGGTTAAAACAGAAAAAATCAGTAACAGTACTAGATGTGGGG­GATGCATATT
TTTCAGTTCCATTAGATGAAAGCTTTAGAAAGTATACTGCATTCACTATACCTAGTATAA­ATAATGARAC
ACCAGGAATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAAT­ATTCCAAAGT
AGCATGACAAAAATCTTAGAGCCCTTTAGAAARAGAAAYCCAGAAATGGTGATCTACCAA­TACATGGATG
ATTTATATGTGGGATCTGACTTAGAATTAGGACAACATAGAGCAAAAATAGAAGAGTTAA­GAGAGCATTT
ACTGARATGGGGATTTACCACACCAGATAARAARCATCAGAAAGAACCTCCATTCTTRTG­GATGGGATAT
GAGCTCCATCCTGACAARTGGACGGTACAACCTATACAGTTGCCAGATAAAGARAGCTGG­ACTGTCAATG
ATATACAAAAGCTAGTGGGAAAACTAAATTGGGCAAGTCAGATTTATCCAGGAATTAGAA­TAAGGCAACT
ATGTAAACTCATTAGGGGGGCTAAAGCACTAACAGACATAGTACCACTAACARAAGAAGC­AGAGCTAGCA
CTA

то мы знаем, не только, что это ВИЧ, но так же, что это ВИЧ-1, что он похож на изолят из России, и можем смело ставить ВИЧ+ диагноз.
[/QUOTE]
на что последовал ответ:

[B]tgg[/B]
[QUOTE][QUOTE]Цитата
Решил проверить данное утверждение на вшивость. Благо это моя прямая специальность - поиск генов в геноме человека.

Итак, берем последовательность gag ВИЧ-1 человека

Итак, кидаем эту последовательность в программ BLast против генома человека

[/QUOTE]
Спрашивается, зачем кидать РНК в программу поиска ДНК???? Смысл????
[/QUOTE]

[QUOTE]PS: глянула на секвенс, выложенную Art.Intel. в качестве вирусной РНК. Вот ее начало:

ATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAA

Где тут урацил, я вас спрашиваю? Вы что там секвенировали-та???? Разве вы не знаете, что при транскрипции происходит сплайсинг (т.е. вырезание кусков транскриптов) продукта???? В итоге цепочка готовой РНК не является зеркальным отображением ДНК.

Интересный вы народ, товарищи ортодоксы. Сначала берете РНК, о происхождении которой наверняка известно только то, что она болтается в определенной фракции после центрифугирования в градиенте плотности. Потом проводите над этой безродной РНК дополнительные манипуляции, исходя из чисто механистических представлений о взаимосвязи между ДНК и РНК, и представляете нам результат своих экспериментов, лишенных какого-либо биологического смысла, как некое доказательство. Самим-то не смешно?[/QUOTE]
[QUOTE]
Ну, а теперь дискотека! Как говорится, especially for you, господа ортодоксы.

Эх, жаль ArtInt. в разъездах. Надеюсь, что мой пост не ускользнет от его внимания.

Текст из патента на выявление РНК ВИЧ с помощью ПЦР:
www.patentstorm.us/patents/6531588/description.html

Novel PCR primers were developed and used to amplify the 0.7 kb, 1.57 kb, or 2.1 kb regions of HIV pol. The unique PCR primers hybridize to highly conserved regions of pol. According to certain embodiments, the PCR application employs a hot start enzyme, such as AmpliTaq Gold. The novel HIV pol amplification primers are:

0.7 kb primers-GGACTGTCAATGACATACAGMGTTAGTGG (SEQ ID NO:3), and

GGTTAAAATCACTAGCCATTGCTCTCC (SEQ ID NO:4);

1.57 kb primers-GGAAAAGGGCTGTTGGAAATGTG (SEQ ID NO:1), and

GGCTCTTGATAAATTTGATATGTCCATTG (SEQ ID NO:2),

2.1 kb primers-CTCATGTTCATCTTGGGCCTTATCTATTC (SEQ ID NO:13), and either

GCCAGGGAATTTTCTTCAGAGCAG (SEQ ID NO:12), or

GGCCAGGGMTTTTCTTCAGAGC (SEQ ID NO:14).

Итак, утверждается, что эти праймеры высокоспецифичны для ВИЧ.
Теперь заходим в программу Blast, разрекламированную Art.Intel., онлайн
blast.ncbi.nlm.nih.gov/Blast.цги
Выбираем nucleotide blast, затем human genomic и highly similar sequences и по совету того же автора закидываем туда последовательности праймеров.

Вот что у меня получилось для первых трех:
GGACTGTCAATGACATACAGMGTTAGTGG - 792 Blast Hits
GGTTAAAATCACTAGCCATTGCTCTCC - 2180 Blast Hits


GGAAAAGGGCTGTTGGAAATGTG - 1525 Blast Hits.

Вот вам и уникальные праймеры. biggrin.gif biggrin.gif biggrin.gif[/QUOTE]

[QUOTE]Оставшиеся четыре

GGCTCTTGATAAATTTGATATGTCCATTG (SEQ ID NO:2),
4511 Blast Hits

2.1 kb primers-CTCATGTTCATCTTGGGCCTTATCTATTC (SEQ ID NO:13),
1650 Blast Hits

GCCAGGGAATTTTCTTCAGAGCAG (SEQ ID NO:12)
3724 Blast Hits

GGCCAGGGMTTTTCTTCAGAGC (SEQ ID NO:14).
3254 Blast Hits

Ну, давайте, выкручивайтесь уже как-нибудь... laugh.gif laugh.gif laugh.gif


Из вашей же ссылки, об электронной микроскопии:

The ‘‘positive’’ contrast observed in thin section EM is mainly due to the heavy metals bound to the specimen and their scattering power, i.e., the distribution of heavy elements is shown rather than the details of the object itself (Figs.1, 5).

Thin section EM involves chemical fixation and complete dehydration of the specimen which definitely abolish any ‘‘natural’’ state of biological structures.

smile.gif
[/QUOTE]

К сожалению, похоже, [B]ArtificalIntelligent[/B] выбыл из обсуждения может ли кто-нибудь прокомментировать этот момент или заменить выбывшего?
http://forum.1tv.ru/index.php?showforum=149
Изменено: Warlock - 06.05.2010 13:05:00
Страницы: 1